simavs  (Addgene inc)

Journal: iScience

Article Title: Viral sensing by epithelial cells involves PKR- and caspase-3-dependent generation of gasdermin E pores

doi: 10.1016/j.isci.2023.107698

Figure Lengend Snippet: Caspase-3 and caspase-8, but not caspase-1, mediate GSDM cleavage after IAV infection (A) NHBE were infected with IAV WSN at MOI 0.1 and viral titers were determined by plaque assay at 0, 8, 24, and 48 h post infection (hpi). Data are mean ± SEM of two independent biological experiments, each performed in duplicate. (B–I) NHBE were infected with IAV WSN with MOI 1 (and also 0.1 in (B)) for 24 h. (B) Cell lysates (WCL) and supernatants (SN) were immunoblotted for GSDMD, GSDME, IAV nucleocapsid protein (NP), and β-actin. (C–E) NHBE cells were treated with DMSO vehicle control, caspase-1 inhibitor (VX765), caspase-3 inhibitor (DEVD), or caspase-8 inhibitor (IETD, all 20 μM) for 1 h before IAV WSN inoculation. (C) Cell lysates and supernatants were immunoblotted for GSDMD, GSDME, caspase-1, caspase-3, and β-actin. (D) Lytic cell death was assessed by measuring LDH release in the supernatant. (E) IL-1β secretion was quantified by ELISA. (F–H) NHBE cells were transfected with siRNA targeting ASC (siASC), MAVS (siMAVS), or NLRP1 (siNLRP1), or control siRNA (siCont) at 24 and 48 h post-seeding of cells. The following day, cells were inoculated with IAV WSN. (F) Cell lysates and supernatants were immunoblotted for GSDMD, GSDME, and β-actin. (G) Lytic cell death was assessed by measuring LDH release in the supernatant. (H) IL-1β secretion was quantified by ELISA. (I) NHBE cells were treated with DMSO vehicle control or caspase-8 inhibitor (IETD, 20 μM) for 1 h before IAV WSN inoculation. Cell lysates and supernatants were immunoblotted for GSDMD, GSDME, caspase-3, caspase-8, and β-actin. Immunoblots are representative of three independent experiments. Other data are mean ± SEM of three (D, E) or four (G, H) independent biological experiments, each performed in triplicate. ns: not significant, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001 and ∗∗∗∗p < 0.0001 by one-way ANOVA. See also Figure S1 .

Article Snippet: siMAVS targeting sequence: TTAAAGGAGTTTATCGATGTA , Qiagen , Cat#SI04272702.

Techniques: Infection, Plaque Assay, Control, Enzyme-linked Immunosorbent Assay, Transfection, Western Blot

Journal: iScience

Article Title: Viral sensing by epithelial cells involves PKR- and caspase-3-dependent generation of gasdermin E pores

doi: 10.1016/j.isci.2023.107698

Figure Lengend Snippet:

Article Snippet: siMAVS targeting sequence: TTAAAGGAGTTTATCGATGTA , Qiagen , Cat#SI04272702.

Techniques: Virus, Recombinant, High Molecular Weight, Enzyme-linked Immunosorbent Assay, Cytotoxicity Assay, Lactate Dehydrogenase Assay, Sequencing, Negative Control, Software

Journal: Journal of Inflammation Research

Article Title: Chinese Herbal Medicine Suyin Detoxification Granule Inhibits Pyroptosis and Epithelial-Mesenchymal Transition by Downregulating MAVS/NLRP3 to Alleviate Renal Injury

doi: 10.2147/JIR.S341598

Figure Lengend Snippet: SDP inhibited the localization and activation of NLRP3 in mitochondria by regulating MAVS protein. ( A , B ) The effects of MAVS siRNA and SDP on BSA-induced cell injury. HK-2 cells were transfected with either NLRP3 siRNA or control siRNA for 8 h. The transfected cells were incubated with BSA for 24 h. HK-2 cells were divided into 6 groups - Control, BSA (10 g/L), SDP (1 g/L), BSA (10 g/L) + SDP (1 g/L), siMAVS (80 nmol/L), and BSA (10 g/L) + MAVS (80 nmol/L). Cell lysates were subjected to Western blotting to measure MAVS and NLRP3 levels. ( C ) mRNA levels of NLRP3 and MAVS were measured using RT-PCR. ( D ) The co-localization of MAVS and NLRP3 was observed using immunofluorescence staining. ( E ) Annexin V -FITC and PI channels were used to observe cell pyroptosis. Data are expressed as means ± SD; n = 3. # P < 0.05; ## P < 0.01 vs control. * P < 0.05; ** P < 0.01 vs the BSA group.

Article Snippet: HK-2 cells were transiently transfected with siRNA specifically targeting MAVS. siMAVS and sicontrol (negative reference) were provided by Nanjing KeyGen biological co., LTD and were diluted in Opti medium to a final concentration of 80 nM.

Techniques: Activation Assay, Transfection, Control, Incubation, Western Blot, Reverse Transcription Polymerase Chain Reaction, Immunofluorescence, Staining

Journal: Frontiers in Immunology

Article Title: Inflammasome-Independent Role of NLRP3 Mediates Mitochondrial Regulation in Renal Injury

doi: 10.3389/fimmu.2018.02563

Figure Lengend Snippet: The mitochondrial adaptor MAVS mediates NLRP3 mitochondrial localization. (A) Hypoxia-exposed HK-2 cells were analyzed by confocal microscopy for NLRP3 and MAVS expression. (B) HK-2 cells were transfected with siMAVS and subjected to 6 h of hypoxia. Cell lysates were immunoprecipitated using anti-NLRP3 antibody, and the immunoprecipitates were immunoblotted with anti-MAVS antibody. (C,D) HK-2 cells were transfected with siMAVS and subjected to 6 h hypoxia. HK-2 cells were stained MitoSOX and analyzed by flow cytometry. (E,F) HK-2 cells were transfected with siMAVS and subjected to 6 h of hypoxia. HK-2 cells were stained with JC-1 and analyzed by flow cytometry. Representative histograms and quantified levels are shown. * p < 0.05 vs. Control, # p < 0.05 vs. Hypoxia.

Article Snippet: Duplex small interfering RNAs (siRNAs) targeting NLRP3 (ORIGENE, Rockville, MD, USA) and a control siRNA, siASC, siCaspase-1 and siMAVS were purchased from Bioneer Inc. (Seoul, Korea).

Techniques: Confocal Microscopy, Expressing, Transfection, Immunoprecipitation, Staining, Flow Cytometry, Control